Inactivation of cytidine triphosphate synthase 1 prevents fatal auto-immunity in mice.

De novo synthesis of the pyrimidine, cytidine triphosphate (CTP), is crucial for DNA/RNA metabolism and depends on the CTP synthetases, CTPS1 and -2. Partial CTPS1 deficiency in humans has previously been shown to lead to immunodeficiency, with impaired expansion of T and B cells. Here, we examine the effects of conditional and inducible inactivation of Ctps1 and/or Ctps2 on mouse embryonic development and immunity. We report that deletion of Ctps1, but not Ctps2, is embryonic-lethal. Tissue and cells with high proliferation and renewal rates, such as intestinal epithelium, erythroid and thymic lineages, activated B and T lymphocytes, and memory T cells strongly rely on CTPS1 for their maintenance and growth. However, both CTPS1 and CTPS2 are required for T cell proliferation following TCR stimulation. Deletion of Ctps1 in T cells or treatment with a CTPS1 inhibitor rescued Foxp3-deficient mice from fatal systemic autoimmunity and reduced the severity of experimental autoimmune encephalomyelitis. These findings support that CTPS1 may represent a target for immune suppression.

Viral RNA Replication Suppression of SARS-CoV-2: Atomistic Insights into Inhibition Mechanisms of RdRp Machinery by ddhCTP.

The nonstructural protein 12, known as RNA-dependent RNA polymerase (RdRp), is essential for both replication and repair of the viral genome. The RdRp of SARS-CoV-2 has been used as a promising candidate for drug development since the inception of the COVID-19 spread. In this work, we performed an in silico investigation on the insertion of the naturally modified pyrimidine nucleobase ddhCTP into the SARS-CoV-2 RdRp active site, in a comparative analysis with the natural one (CTP). The modification in ddhCTP involves the removal of the 3'-hydroxyl group that prevents the addition of subsequent nucleotides into the nascent strand, acting as an RNA chain terminator inhibitor. Quantum mechanical investigations helped to shed light on the mechanistic source of RdRp activity on the selected nucleobases, and comprehensive all-atom simulations provided insights about the structural rearrangements occurring in the active-site region when inorganic pyrophosphate (PPi) is formed. Subsequently, the intricate pathways for the release of PPi, the catalytic product of RdRp, were investigated using Umbrella Sampling simulations. The results are in line with the available experimental data and contribute to a more comprehensive point of view on such an important viral enzyme.

Association of tenofovir diphosphate and lamivudine triphosphate concentrations with HIV and hepatitis B virus viral suppression.

OBJECTIVE: Concentrations of tenofovir diphosphate (TFV-DP) and lamivudine triphosphate (3TC-TP) in cells are correlates of medication adherence and antiviral activity. However, studies have yet to characterize the simultaneous relationship between TFV-DP and 3TC-TP concentrations with HIV and hepatitis B virus (HBV) suppression. METHODS: Individuals with HIV/HBV coinfection on tenofovir disoproxil fumarate (TDF)-containing antiretroviral therapy (ART) were enrolled. Peripheral blood mononuclear cells (PBMCs) and dried blood spots (DBS) samples were collected and steady-state TFV-DP and 3TC-TP concentrations quantified using validated methods. The relationship between patient factors, TFV-DP, and 3TC-TP concentrations in PBMCs and DBS with HBV and HIV viral suppression were examined. RESULTS: Of 138 participants on TDF-containing ART for a median duration (range) of 6 (0.75-15) years, the median age was 43 years and 64% were women. Overall, 128 (92.8%) and 129 (93.5%) had suppressed HIV and HBV viral loads, respectively. Of the 128 participants with suppressed HIV, 122 (95.3%) had suppressed HBV. Self-reported ART adherence, recent change to dolutegravir-based ART, TFV-DP, and 3TC-TP concentrations in PBMCs and DBS were associated with HIV RNA suppression, while HBe antigen positivity, HIV suppression, and TFV-DP concentrations in DBS were associated with HBV DNA suppression (including six persons with HBV nonsuppression and HIV suppression). CONCLUSION: Long-term TDF/3TC-conatining ART was highly efficacious in individuals with HIV/HBV coinfection. Higher TFV-DP concentrations were predictive of suppression for both viruses. Persistent HBV viremia on TDF/3TC-containg ART requires additional research, but may represent poor adherence and the need for adherence interventions or novel antivirals.

Computational aided design of a halotolerant CMP kinase for enzymatic synthesis of cytidine triphosphate.

The current biocatalytic method of industrial Cytidine triphosphate (CTP) production suffers from reaction rate loss. It is caused by gradually increasing acetate salt concentration, which inhibits enzyme activities and decreases the final yield. This work gave a possible solution to this problem through computational aided design of CMP kinase (CMPK), an enzyme in the CTP production system, to increase its stability in solution with high acetate salt concentration. Enlightened by the features of natural halophilic enzymes, the basic and neutral surface residues were replaced with acidic amino acids. This protein design strategy effectively increased the activity of CMPK in the working condition (acetate concentration over 1200 mM). The halotolerant CMPK was applied in fed-batch production of CTP. The maximum titer was 201.4 ± 1.6 mM, and the productivity was 12.6 mM L-1 h-1, increased 26.4% and 27.8% from the process using wild-type CMPK, respectively.

Synthesis of Cy5-Labelled C5-Alkynyl-modified cytidine triphosphates via Sonogashira coupling for DNA labelling.

New applications of palladium-catalyzed Sonogashira-type cross-coupling reaction between C5-halogenated 2'-deoxycytidine-5'-monophosphate and novel cyanine dyes with a terminal alkyne group have been developed. The present methodology allows to synthesize of fluorescently labeled C5-nucleoside triphosphates with different acetylene linkers between the fluorophore and pyrimidine base in good to excellent yields under mild reaction conditions. Modified 2'-deoxycytidine-5'-triphosphates were shown to be good substrates for DNA polymerases and were incorporated into the DNA by polymerase chain reaction.

Super-Resolution Imaging Reveals Dynamic Reticular Cytoophidia.

CTP synthase (CTPS) can form filamentous structures termed cytoophidia in cells in all three domains of life. In order to study the mesoscale structure of cytoophidia, we perform fluorescence recovery after photobleaching (FRAP) and stimulated emission depletion (STED) microscopy in human cells. By using an EGFP dimeric tag as a tool to explore the physical properties of cytoophidia, we find that cytoophidia are dynamic and reticular. The reticular structure of CTPS cytoophidia may provide space for other components, such as IMPDH. In addition, we observe CTPS granules with tentacles.

Identification and biochemical characterization of a novel N-acetylglucosamine kinase in Saccharomyces cerevisiae.

N-acetylglucosamine (GlcNAc) is a key component of glycans such as glycoprotein and the cell wall. GlcNAc kinase is an enzyme that transfers a phosphate onto GlcNAc to generate GlcNAc-6-phosphate, which can be a precursor for glycan synthesis. GlcNAc kinases have been found in a broad range of organisms, including pathogenic yeast, human and bacteria. However, this enzyme has never been discovered in Saccharomyces cerevisiae, a eukaryotic model. In this study, the first GlcNAc kinase from S. cerevisiae was identified and named Ngk1. The Km values of Ngk1 for GlcNAc and glucose were 0.11 mM and 71 mM, respectively, suggesting that Ngk1 possesses a high affinity for GlcNAc, unlike hexokinases. Ngk1 showed the GlcNAc phosphorylation activity with various nucleoside triphosphates, namely ATP, CTP, GTP, ITP, and UTP, as phosphoryl donors. Ngk1 is phylogenetically distant from known enzymes, as the amino acid sequence identity with others is only about 20% or less. The physiological role of Ngk1 in S. cerevisiae is also discussed.

Molecular Mechanism of Hydrotropic Properties of GTP and ATP.

Hydrotropes are small amphiphilic compounds that increase the aqueous solubility of hydrophobic molecules. Recent evidence suggests that adenosine triphosphate (ATP), which is the primary energy carrier in cells, also assumes hydrotropic properties to prevent the aggregation of hydrophobic proteins, but the mechanism of hydrotropy is unknown. Here, we compare the hydrotropic behavior of all four biological nucleoside triphosphates (NTPs) using molecular dynamics (MD) simulations. We launch all atom MD simulations of aqueous solutions of NTPs [ATP, guanosine triphosphate (GTP), cytidine triphosphate (CTP), and uridine triphosphate (UTP)] with pyrene, which acts both as a model hydrophobic compound and as a spectroscopic reporter for aggregation. GTP prevents pyrene aggregation effectively. Dissolution is not achieved in the presence of CTP and UTP. The higher stability of the base stacking in guanine is responsible for the higher hydrotropic efficiency of GTP. Consistent with the simulations, spectroscopic measurements also suggest that the hydrotropic activity of GTP is higher than ATP. Stacking of aromatic pyrene with the aromatic base of NTPs is a characteristic feature of this hydrotropic property. Both ATP and GTP also dissolve clusters of di- and tripeptides containing tryptophan but with equal potency. Importantly, the presence of aromatic amino acids is a necessary condition for the hydrotropic potency of ATP and GTP. Our results can have broad implications for hydrotrope design in the pharmaceutical industry, as well as the possibility of cells employing GTP as a hydrotrope to regulate the hydrophobic protein aggregation in membrane-less biological condensates.

On the Recognition of Natural Substrate CTP and Endogenous Inhibitor ddhCTP of SARS-CoV-2 RNA-Dependent RNA Polymerase: A Molecular Dynamics Study.

The novel coronavirus SARS-CoV-2 is the causative agent of the COVID-19 outbreak that is affecting the entire planet. As the pandemic is still spreading worldwide, with multiple mutations of the virus, it is of interest and of help to employ computational methods for identifying potential inhibitors of the enzymes responsible for viral replication. Attractive antiviral nucleotide analogue RNA-dependent RNA polymerase (RdRp) chain terminator inhibitors are investigated with this purpose. This study, based on molecular dynamics (MD) simulations, addresses the important aspects of the incorporation of an endogenously synthesized nucleoside triphosphate, ddhCTP, in comparison with the natural nucleobase cytidine triphosphate (CTP) in RdRp. The ddhCTP species is the product of the viperin antiviral protein as part of the innate immune response. The absence of the ribose 3'-OH in ddhCTP could have important implications in its inhibitory mechanism of RdRp. We built an in silico model of the RNA strand embedded in RdRp using experimental methods, starting from the cryo-electron microscopy structure and exploiting the information obtained by spectrometry on the RNA sequence. We determined that the model was stable during the MD simulation time. The obtained results provide deeper insights into the incorporation of nucleoside triphosphates, whose molecular mechanism by the RdRp active site still remains elusive.

Ubiquitination regulates cytoophidium assembly in Schizosaccharomyces pombe.

CTP synthase (CTPS), a metabolic enzyme responsible for the de novo synthesis of CTP, can form filamentous structures termed cytoophidia, which are evolutionarily conserved from bacteria to humans. Here we used Schizosaccharomyces pombe to study the cytoophidium assembly regulation by ubiquitination. We tested the CTP synthase's capacity to be post-translationally modified by ubiquitin or be affected by the ubiquitination state of the cell and showed that ubiquitination is important for the maintenance of the CTPS filamentous structure in fission yeast. We have identified proteins which are in complex with CTPS, including specific ubiquitination regulators which significantly affect CTPS filamentation, and mapped probable ubiquitination targets on CTPS. Furthermore, we discovered that a cohort of deubiquitinating enzymes is important for the regulation of cytoophidium's filamentous morphology. Our study provides a framework for the analysis of the effects that ubiquitination and deubiquitination have on the formation of cytoophidia.

CTPS cytoophidia formation affects cell cycle progression and promotes TSN­induced apoptosis of MKN45 cells.

Cytidine triphosphate synthase (CTPS) forms filamentous structures termed cytoophidia in numerous types of cell. Toosendanin (TSN) is a tetracyclic triterpenoid and induces CTPS to form cytoophidia in MKN45 cells. However, the effects of CTPS cytoophidia on the proliferation and apoptosis of human gastric cancer cells remain poorly understood. In the present study, CTPS­overexpression and R294D­CTPS mutant vectors were generated to assess the effect of CTPS cytoophidia on the proliferation and apoptosis of gastric cancer MKN45 cells. Formation of CTPS cytoophidia significantly inhibited MKN45 cell proliferation (evaluated using EdU incorporation assay), significantly blocked the cell cycle in G1 phase (assessed using flow cytometry) and significantly decreased mRNA and protein expression levels of cyclin D1 (assessed by reverse transcription­quantitative PCR and western blotting, respectively). Furthermore, the number of apoptotic bodies and apoptosis rate were markedly elevated and mitochondrial membrane potential was markedly decreased. Moreover, mRNA and protein expression levels of Bax increased and Bcl­2 decreased markedly in MKN45 cells following transfection with the CTPS­overexpression vector. The proliferation rate increased, percentage of G1/G0­phase cells decreased and apoptosis was attenuated in cells transfected with the R294D­CTPS mutant vector and this mutation did not lead to formation of cytoophidia. The results of the present study suggested that formation of CTPS cytoophidia inhibited proliferation and promoted apoptosis in MKN45 cells. These results may provide insights into the role of CTPS cytoophidia in cancer cell proliferation and apoptosis.

Comparison of Two Software Packages for Perfusion Imaging: Ischemic Core and Penumbra Estimation and Patient Triage in Acute Ischemic Stroke.

Purpose: Automated postprocessing packages have been developed for managing acute ischemic stroke (AIS). These packages identify ischemic core and penumbra using either computed tomographic perfusion imaging (CTP) data or magnetic resonance imaging (MRI) data. Measurements of abnormal tissues and treatment decisions derived from different vendors can vary. The purpose of this study is to investigate the agreement of volumetric and decision-making outcomes derived from two software packages. Methods: A total of 594 AIS patients (174 underwent CTP and 420 underwent MRI) were included. Imaging data were accordingly postprocessed by two software packages: RAPID and RealNow. Volumetric outputs were compared between packages by performing intraclass correlation coefficient (ICC), Wilcoxon paired test and Bland-Altman analysis. Concordance of selecting patients eligible for mechanical thrombectomy (MT) was assessed based on neuroimaging criteria proposed in DEFUSE3. Results: In the group with CTP data, mean ischemic core volume (ICV)/penumbral volume (PV) was 14.9/81.1 mL via RAPID and 12.6/83.2 mL via RealNow. Meanwhile, in the MRI group, mean ICV/PV were 52.4/68.4 mL and 48.9/61.6 mL via RAPID and RealNow, respectively. Reliability, which was measured by ICC of ICV and PV in CTP and MRI groups, ranged from 0.87 to 0.99. The bias remained small between measurements (CTP ICV: 0.89 mL, CTP PV: -2 mL, MRI ICV: 3.5 mL and MRI PV: 6.8 mL). In comparison with CTP ICV with follow-up DWI, the ICC was 0.92 and 0.94 for RAPID and Realnow, respectively. The bias remained small between CTP ICV and follow-up DWI measurements (Rapid: -4.65 mL, RealNow: -3.65 mL). Wilcoxon paired test showed no significant difference between measurements. The results of patient triage were concordant in 159/174 cases (91%, ICC: 0.90) for CTP and 400/420 cases (95%, ICC: 0.93) for MRI. Conclusion: The CTP ICV derived from RealNow was more accurate than RAPID. The similarity in volumetric measurement between packages did not necessarily relate to equivalent patient triage. In this study, RealNow showed excellent agreement with RAPID in measuring ICV and PV as well as patient triage.

Stochastically multimerized ParB orchestrates DNA assembly as unveiled by single-molecule analysis.

The tripartite ParABS system mediates chromosome segregation in a wide range of bacteria. Dimeric ParB was proposed to nucleate on parS sites and spread to neighboring DNA. However, how properly distributed ParB dimers further compact chromosomal DNA into a higher-order nucleoprotein complex for partitioning remains poorly understood. Here, using a single-molecule approach, we show that tens of Bacillus subtilis ParB (Spo0J) proteins can stochastically multimerize on and stably bind to nonspecific DNA. The introduction of CTP promotes the formation and diffusion of the multimeric ParB along DNA, offering an opportunity for ParB proteins to further forgather and cluster. Intriguingly, ParB multimers can recognize parS motifs and are more inclined to remain immobile on them. Importantly, the ParB multimer features distinct capabilities of not only bridging two independent DNA molecules but also mediating their transportation, both of which are enhanced by the presence of either CTP or parS in the DNA. These findings shed new light on ParB dynamics in self-multimerization and DNA organization and help to better comprehend the assembly of the ParB-DNA partition complex.

Guidelines for organization, operation and evaluation of clinical trials pharmacies in Brazil: a scope review. / Diretrizes para organização, funcionamento e avaliação de farmácias de ensaios clínicos no Brasil: revisão de escopo.

The development of new drugs depends on several scientific steps, which culminate in clinical trials. The clinical trials pharmacy (CTP) is the place for receiving, preparing, storing and dispensing the investigational product or study drug. Therefore, it must have infrastructure and procedures that guarantee participant safety and quality of research data. This study aimed to systematize guidelines for CTP in Brazil. We conducted a scope review and organized the results using the Ishikawa Method (6Ms). In total, 51 publications were selected for each "M", 39 laws, regulations or guidelines and 12 scientific articles: 25 publications for pharmaceutical services (pharmacy procedures to ensure participant safety from investigational product ordering to final disposition), 14 for Quality Indicators, 12 for Human Resources, 11 for Infrastructure, 11 for Material Resources and 5 for Investigational Product. Our results synthesize information for the organization, operation and evaluation of CTP in Brazil, emphasizes the inclusion of the pharmacist within the clinical trials context, and contributes to preparation for monitoring, auditing, and inspections conducted by regulatory agencies.

O desenvolvimento de novos medicamentos depende de etapas científicas que culminam nos ensaios clínicos em seres humanos. A farmácia de ensaios clínicos (FEC) é o local destinado ao recebimento, preparação, armazenamento e dispensação do produto investigacional (PI). Para tanto, deve possuir infraestrutura e procedimentos que garantam a segurança do participante e a qualidade da pesquisa. Este trabalho teve por objetivo sistematizar diretrizes para FEC no Brasil. Foi realizada uma revisão de escopo e as diretrizes foram organizadas utilizando o método de Ishikawa ("método 6Ms"). No total foram selecionadas 51 publicações, sendo 39 diretrizes e normas e 12 artigos científicos para cada "M"; 25 descreveram o ciclo de assistência farmacêutica (procedimentos para assegurar a segurança dos participantes, desde a requisição do produto até a destinação final), 14 indicadores de qualidade, 12 de recursos humanos, 11 de infraestrutura e recursos materiais e 5 descreveram PIs. para organização, funcionamento e avaliação de FEC no Brasil e corroboram a necessidade da presença do profissional farmacêutico no ciclo da assistência farmacêutica no contexto dos ensaios clínicos, contribuindo ainda na preparação para monitorias, auditorias e inspeções de agências regulatórias.

Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

[Preparation and in vitro evaluation of fused deposition modeling 3D printed compound tablets of captopril and hydrochlorothiazide].

OBJECTIVE: To explore the feasibility of preparing compound tablets for the treatment of hypertension by fused deposition modeling (FDM) 3D printing technology and to evaluate the quality of the printed compound tablets in vitro. METHODS: Polyvinyl alcohol (PVA) filaments were used as the exci-pient to prepare the shell of tablet. The ellipse-shaped tablets (the length of major axes of ellipse was 20 mm, the length of the minor axes of ellipse was 10 mm, the height of tablet was 5 mm) with two separate compartments were designed and printed using FDM 3D printer. The height of layer was 0.2 mm, and the thickness of roof or floor was 0.6 mm. The thickness of shell was 1.2 mm, and the thickness of the partition wall between the two compartments was 0.6 mm. Two cardiovascular drugs, captopril (CTP) and hydrochlorothiazide (HCT), were selected as model drugs for the printed compound tablet and filled in the two compartments of the tablet, respectively. The microscopic morphology of the tablets was observed by scanning electron microscopy (SEM). The weight variation of the tablets was investigated by electronic scale. The hardness of the tablets was measured by a single-column mechanical test system. The contents of the drugs in the tablets were determined by high performance liquid chromatography (HPLC), and the dissolution apparatus was used to measure the in vitro drug release of the tablets. RESULTS: The prepared FDM 3D printed compound tablets were all in good shape without printing defects. The average weight of the tablets was (644.3±6.55) mg. The content of CTP and HCT was separately (52.3±0.26) mg and (49.6±0.74) mg. A delayed in vitro release profile was observed for CTP and HCT, and the delayed release time for CTP and HCT in vitro was 20 min and 40 min, respectively. The time for 70% of CTP and HCT released was separately 30 min and 60 min. CONCLUSION: CTP and HCT compound tablets were successfully prepared by FDM 3D printing technology, and the printed tablets were of good qualities.

Combined toxicity and toxicity persistence of antidepressants citalopram and mirtazapine to zooplankton Daphnia magna.

Citalopram (CTP) and mirtazapine (MTP) are two typical psychoactive drugs used for the depression treatment. As emerging pollutants, CTP and MTP have raised concern because of their harmful effect on aquatic organisms. Therefore, the ecotoxicological risk of these two pollutants to aquatic organisms should be given more attention. In this study, the effects of CTP and MTP on the feeding rate, heartbeat, nutritional enzymes, and their related gene expression of D. magna were investigated under single and binary mixture pollutant exposure. Subsequently, the recovery of exposed D. magna was studied to assess the toxic persistence of those pollutants. After 24-h exposure, the ingestion rate decreased by 34.2% and 21.5%, in the group of 1.45 mg/L CTP (C-H) and binary mixture with high concentration (Mix-H), respectively. After 24-h recovery, the feeding rate of D. magna was stimulated by a compensatory response. Over the exposure period, the heartbeat rate of D. magna increased significantly in the groups of CTP, MTP, and their binary mixture with low concentration (Mix-L), and then, their heartbeat rate was recovered during the recovery period. The activity of α-amylase (AMS) and trypsin were significantly changed in most of the exposed daphnia, both during the exposure and recovery period. CTP/MTP exposure stimulated the expression of the AMS gene. MTP and Mix-H exposure inhibited the expression of the trypsin gene and the other groups stimulated its expression. After 24-h recovery, the stimulating or inhibitory effects were alleviated. There were different responses between gene expression and enzyme activity. In conclusion, our results highlighted the toxic effects at high concentrations of single and mixed pollution of CTP and MTP on the feeding rate, heartbeat, AMS and trypsin enzyme activity, and expression of related genes of D. magna to assess the environment risk of them.

GTP-Dependent Regulation of CTP Synthase: Evolving Insights into Allosteric Activation and NH3 Translocation.

Cytidine-5'-triphosphate (CTP) synthase (CTPS) is the class I glutamine-dependent amidotransferase (GAT) that catalyzes the last step in the de novo biosynthesis of CTP. Glutamine hydrolysis is catalyzed in the GAT domain and the liberated ammonia is transferred via an intramolecular tunnel to the synthase domain where the ATP-dependent amination of UTP occurs to form CTP. CTPS is unique among the glutamine-dependent amidotransferases, requiring an allosteric effector (GTP) to activate the GAT domain for efficient glutamine hydrolysis. Recently, the first cryo-electron microscopy structure of Drosophila CTPS was solved with bound ATP, UTP, and, notably, GTP, as well as the covalent adduct with 6-diazo-5-oxo-l-norleucine. This structural information, along with the numerous site-directed mutagenesis, kinetics, and structural studies conducted over the past 50 years, provide more detailed insights into the elaborate conformational changes that accompany GTP binding at the GAT domain and their contribution to catalysis. Interactions between GTP and the L2 loop, the L4 loop from an adjacent protomer, the L11 lid, and the L13 loop (or unique flexible "wing" region), induce conformational changes that promote the hydrolysis of glutamine at the GAT domain; however, direct experimental evidence on the specific mechanism by which these conformational changes facilitate catalysis at the GAT domain is still lacking. Significantly, the conformational changes induced by GTP binding also affect the assembly and maintenance of the NH3 tunnel. Hence, in addition to promoting glutamine hydrolysis, the allosteric effector plays an important role in coordinating the reactions catalyzed by the GAT and synthase domains of CTPS.

Phase 2 randomized, dose-ranging trial of CTP-543, a selective Janus Kinase inhibitor, in moderate-to-severe alopecia areata.

BACKGROUND: Janus kinase (JAK) activation is suggested to have a pathological role in alopecia areata (AA). CTP-543, a deuterated compound that selectively inhibits JAK1 and JAK2, is being developed as an oral treatment for AA. OBJECTIVE: To assess the safety and efficacy of a 24-week regimen of CTP-543 in patients with chronic, moderate-to-severe AA. METHODS: In this phase 2, randomized, double-blind, placebo-controlled, sequential-design trial, patients were randomized to receive CTP-543 (4 mg, 8 mg, or 12 mg) or placebo every 12 hours for 24 weeks. RESULTS: A dose-related increase was observed in the percentage of patients with ≥50% relative reduction in Severity of Alopecia Tool scores from baseline at week 24 (9% placebo, 21% 4 mg twice daily, 47% 8 mg twice daily, and 58% 12 mg twice daily), with statistical significance versus placebo (P < .001) observed for the 8-mg twice daily and 12-mg twice daily groups, with differences from placebo noted as early as 12 weeks after the initiation of treatment. Safety results were consistent with the known safety profiles of JAK inhibitors. LIMITATIONS: These initial findings are from a relatively small controlled trial, and additional studies are needed to fully characterize the safety and efficacy of CTP-543 in adult patients with AA. CONCLUSIONS: Patients treated with CTP-543 (8 or 12 mg, twice daily) had a significant reduction in the severity of AA.

CTP sensing and Mec1ATR-Rad53CHK1/CHK2 mediate a two-layered response to inhibition of glutamine metabolism.

Glutamine analogs are potent suppressors of general glutamine metabolism with anti-cancer activity. 6-diazo-5-oxo-L-norleucine (DON) is an orally available glutamine analog which has been recently improved by structural modification for cancer treatment. Here, we explored the chemogenomic landscape of DON sensitivity using budding yeast as model organism. We identify evolutionarily conserved proteins that mediate cell resistance to glutamine analogs, namely Ura8CTPS1/2, Hpt1HPRT1, Mec1ATR, Rad53CHK1/CHK2 and Rtg1. We describe a function of Ura8 as inducible CTP synthase responding to inhibition of glutamine metabolism and propose a model for its regulation by CTP levels and Nrd1-dependent transcription termination at a cryptic unstable transcript. Disruption of the inducible CTP synthase under DON exposure hyper-activates the Mec1-Rad53 DNA damage response (DDR) pathway, which prevents chromosome breakage. Simultaneous inhibition of CTP synthase and Mec1 kinase synergistically sensitizes cells to DON, whereas CTP synthase over-expression hampers DDR mutant sensitivity. Using genome-wide suppressor screening, we identify factors promoting DON-induced CTP depletion (TORC1, glutamine transporter) and DNA breakage in DDR mutants. Together, our results identify CTP regulation and the Mec1-Rad53 DDR axis as key glutamine analog response pathways, and provide a rationale for the combined targeting of glutamine and CTP metabolism in DDR-deficient cancers.